CcGM23131

Name	CcGM23131
Genbank ID	N/A
Type	SSR
Species	Cajanus cajan
Repeat Motif	(TAT)18
Primer 1	CcGM23131.Forward: GCGGTTTTGTAGCTCTGGAA
Primer 2	CcGM23131.Reverse: TGCAACCATACCACGACTGT
Product Length	234
Publication	[view all]
Contact	Rajeev Varshney Abhishek Bohra
Comment	scaffold_LG11

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pigeon_pea-ICPL_20340/ICP_15739-F2	LG01	N/A	167.6	CcGM23131	View

Name	Details
Rajeev Varshney	First name: Rajeev Last name: Varshney Title: Researcher Institution: CGIAR Generation Challenge Programme Address: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, Andhra Pradesh, India Country: India Email: r.k.varshney@cgiar.org Phone: +91 40 30713305 Fax: +91 40 30713074 Last update: Nov 2011
Abhishek Bohra	First name: Abhishek Last name: Bohra Title: Researcher Institution: Indian Institute of Pulses Research Address: Crop Improvement DivisionIndian Institute of Pulses ResearchKanpurIndia Country: India Email: abhi.omics@gmail.com Last update: Mar 2017

Year	Publication
2012	Varshney RK, Chen W, Li Y, Bharti AK, Saxena RK, Schlueter JA, Donoghue MTA, Azam S, Fan G, Whaley AM, Farmer AD, Sheridan J, Iwata A, Tuteja R, Penmetsa RV, Wu W, Upadhyaya HD, Yang SP, Shah T, Saxena KB, Michael T, McCombie WR, Yang B, Zhang G, Yang H, Wang J, Spillane C, Cook DR, May GD, Xu X, Jackson SA. Draft genome sequence of pigeonpea (Cajanus cajan), an orphan legume crop of resource-poor farmers. Nature Biotechnology. 2012 Nov 06; 30:83-89.
2020	Bohra A, Jha R, Lamichaney A, Singh D, Jha UC, Naik SJS, Datta D, Maurya AK, Tiwari A, Yadav V, Singh F, Singh IP, Singh NP. Mapping QTL for important seed traits in an interspecific F2 population of pigeonpea.. 3 Biotech. 2020 Oct; 10(10):434.