|
Marker Overview
Name | CcM01971 |
Genbank ID | FI244097 |
Type | SSR |
Species | Cajanus cajan |
Repeat Motif | (ATA)5...(ATA)8 |
Primer 1 | CcM01971.Forward: ATTAATCCATTGGGCCAGGT |
Primer 2 | CcM01971.Reverse: TCGTGTTTTATATGGGCATGA |
Product Length | 215 |
Publication | [view all] |
Contact | Douglas Cook
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | FI244097 |
Publications
Year | Publication |
2011 | Bohra A, Dubey A, Saxena RK, Penmetsa RV, Poornima KN, Kumar N, Farmer AD, Srivani G, Upadhyaya HD, Gothalwal R, Ramesh S, Singh D, Saxena K, Kishor PBK, Singh NK, Town CD, May GD, Cook DR, Varshney RK. Analysis of BAC-end sequences (BESs) and development of BES-SSR markers for genetic mapping and hybrid purity assessment in pigeonpea (Cajanus spp.). BMC Plant Biology. 2011; 11:56. |
|