Lup247

Name	Lup247
Genbank ID	CA411075
Type	STS
Species	Lupinus angustifolius
Primer 1	Lup247.Forward: AGACTGGTTAGAGCACTCAGAT
Primer 2	Lup247.Reverse: ACACAGCAGCACAATTGAC
Publication	[view all]
Contact	Matthew Nelson Simon Ellwood
Comment	Respiratory burst oxidase

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Lupin-83A:476/P27255-RIL	LG12	N/A	59.6	Lup247	View
2	Lupin-83A:476/P27255-RIL-2017	LG12	N/A	53.05	Lup247	View
3	Lupin-83A:476/P27255-RIL-2015	LG12	N/A	52	Lup247	View
4	Lupin-83A:476/P27255-RIL-2010	LG12	N/A	61.3	Lup247	View

Database	Accession
DB:genbank	CA411075

Name	Details
Matthew Nelson	First name: Matthew Last name: Nelson Institution: University of Western Australia Country: Australia Email: matthew.nelson@uwa.edu.au Last update: Mar 2014
Simon Ellwood	First name: Simon Last name: Ellwood Institution: Murdoch University Country: Australia Email: sellwood@murdoch.edu.au Last update: May 2007

Year	Publication
2014	Kroc M, Koczyk G, Święcicki W, Kilian A, Nelson MN. New evidence of ancestral polyploidy in the Genistoid legume Lupinus angustifolius L. (narrow-leafed lupin). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2014 May; 127(5):1237-49.
2006	Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A, O'Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones MGK, Bellgard M, Ksiazkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA. The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula. Theor Appl Genet. 2006; 113:225-238.