GH719668

EST Overview


Name	GH719668
Unique Name	GH719668
Type	EST
Organism	Pisum sativum (pea)
Sequence length	372

Unigenes

This EST is part of the following unigenes:


Unigene Name	Analysis Name	Sequence type in Unigene
Pisum sativum unigene v2	Pisum sativum unigene v2	EST
Pisum sativum unigene v1	Pisum sativum unigene v1	EST

Libraries


Library Name	Type
LIBEST_024268 TI	cdna_library

Analyses

This EST is derived from or has results from the following analyses


Analysis Name	Date Performed
Pisum sativum unigene v1	2010-12-27
Pisum sativum unigene v2	2011-03-01
InterProScan analysis for Pisum sativum unigene v2	2011-04-27
InterProScan analysis for Pisum sativum unigene v1	2010-12-29

InterPro

Analysis Name: InterProScan analysis for Pisum sativum unigene v2
Date Performed: 2011-04-27


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	SEG	seg	seg	coord: 13..30 score: NAcoord: 39..66 score
None	No IPR available	SEG	seg	seg	coord: 15..73 score
None	No IPR available	SEG	seg	seg	coord: 16..70 score
None	No IPR available	SEG	seg	seg	coord: 4..10 score
None	No IPR available	SEG	seg	seg	coord: 1..36 score: NAcoord: 47..57 score
None	No IPR available	SEG	seg	seg	coord: 1..20 score: NAcoord: 37..43 score: NAcoord: 76..86 score

Analysis Name: InterProScan analysis for Pisum sativum unigene v1
Date Performed: 2010-12-29


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	SEG	seg	seg	coord: 13..30 score: NAcoord: 39..66 score
None	No IPR available	SEG	seg	seg	coord: 15..73 score
None	No IPR available	SEG	seg	seg	coord: 16..70 score
None	No IPR available	SEG	seg	seg	coord: 4..10 score
None	No IPR available	SEG	seg	seg	coord: 1..36 score: NAcoord: 47..57 score
None	No IPR available	SEG	seg	seg	coord: 1..20 score: NAcoord: 37..43 score: NAcoord: 76..86 score

Properties


Property Name	Value
Singlet in analysis	Pisum sativum unigene v2
Singlet in analysis	Pisum sativum unigene v1

Sequences

The following sequences are available for this feature:

EST sequence

EST sequence

>GH719668 ID=GH719668; Name=GH719668; organism=Pisum sativum; type=EST; length=372bp
CGAGCGGCGCCCGGGCAGGTCTTATGTTCAATGGTTCTTTTGACAAGCTC
TTTCTTTCCCAATGCCACCGTCCATAGATATAGGCCCAATCTTATCAAAA
GAACCATTGAACATAAGATGAAAAGGAGGACAATAAAGAGAAGCAACATA
TGCGTGGGTGAAAGGAAGCTTTGAGCAGCACCCATCTCCTCCACCACCAC
CAGTGCACACCTATCCTCACCCTCACCCTGTCTACCACTCCCCACCACCA
CCACCAACACCACACAAGAAGCCATACAAGTATCCATCACCACCACCACC
ACCAGCTCACACCTACCCTCACCCACACCCAGTCTACCACTCTCCACCAC
CACACCTCGGCCGCGACCACGC

Search form