AF457590, AF457590 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	AF457590
Genbank ID	AF457590
Type	SNAP
Species	Cicer sp.
Primer 1	AF457590.Forward primer: CTCCCTCTCTATCGCCCTCT
Primer 2	AF457590.Reverse primer: TGTGAAAGGGTTGGTGTGAA
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG5	N/A	32	AF457590	View
2	chickpea-ICC4958xPI489777-RIL-F10	LG5	N/A	35.12	AF457590	View
3	chickpea-ICC4958xPI489777-RIL-F10-2012	LG05	N/A	34.48	AF457590	View
4	chickpea-ICC4958xPI489777-RIL-2010	LG5	N/A	365.3	AF457590	View

References

External references for this genetic_marker


Database	Accession
DB:genbank	AF457590

Publications


Year	Publication
2010	Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441.