CaGMS1312, CaGMS1312 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaGMS1312
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AT)9
Primer 1	CaGMS1312.Forward primer: TTGAACCCCAAATTCTCAGC
Primer 2	CaGMS1312.Reverse primer: AAAGATGGTCCATAGTGAAGCAC
Product Length	237
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG3	N/A	54.57	CaGMS1312	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	49.09	CaGMS1312	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	65.57	CaGMS1312	View

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.