CaGMS1866, CaGMS1866 (genetic_marker) Cicer sp.

Name	CaGMS1866
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AT)9
Primer 1	CaGMS1866.Forward primer: TGGACAATCCGTGGTGTAGA
Primer 2	CaGMS1866.Reverse primer: TGAATGATTTCACCATTTCCAA
Product Length	251
Publication	[view all]

Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.