CaGMS285, CaGMS285 (genetic_marker) Cicer sp.

Name	CaGMS285
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(GAA)11
Primer 1	CaGMS285.Forward primer: TTGCACCAATATCAAATGAAGG
Primer 2	CaGMS285.Reverse primer: CCTGTTGACAACTGAGAAGAGC
Product Length	271
Publication	[view all]

Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.