CaM1599, CaM1599 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CaM1599
Genbank ID	EI881466
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(AC)6
Primer 1	CaM1599.Forward primer: TTGGATGCACAAGAATGGTT
Primer 2	CaM1599.Reverse primer: TGAGGTCATTTTCATCCTTCC
Product Length	221
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	EI881466

Germplasm


Stock Name	Type
ICC4958	accession

Publications


Year	Publication
2011	Thudi M, Bohra A, Nayak SN, Varghese N, Shah TM, Penmetsa RV, Thirunavukkarasu N, Gudipati S, Gaur PM, Kulwal PL, Upadhyaya HD, Kavikishor PB, Winter P, Kahl G, Town CD, Kilian A, Cook DR, Varshney RK. Novel SSR markers from BAC-end sequences, DArT arrays and a comprehensive genetic map with 1,291 marker loci for chickpea (Cicer arietinum L.). PloS one. 2011; 6(11):e27275.