|
Marker Overview
Name | CaM1986 |
Genbank ID | EI888470 |
Type | SSR |
Species | Cicer arietinum |
Germplasm | ICC4958 |
Repeat Motif | (TA)6 |
Primer 1 | CaM1986.Forward primer: CATGCACCAACAGATCCAAC |
Primer 2 | CaM1986.Reverse primer: TTCAATTACCATTGCAGAAGC |
Product Length | 201 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | EI888470 |
Publications
Year | Publication |
2011 | Thudi M, Bohra A, Nayak SN, Varghese N, Shah TM, Penmetsa RV, Thirunavukkarasu N, Gudipati S, Gaur PM, Kulwal PL, Upadhyaya HD, Kavikishor PB, Winter P, Kahl G, Town CD, Kilian A, Cook DR, Varshney RK. Novel SSR markers from BAC-end sequences, DArT arrays and a comprehensive genetic map with 1,291 marker loci for chickpea (Cicer arietinum L.). PloS one. 2011; 6(11):e27275. |
|