CaSTMS8, CaSTMS8 (genetic_marker) Cicer arietinum

Name	CaSTMS8
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GT)10
Primer 1	CaSTMS8.Forward primer: GGACTAGAGGCAGAAGCT
Primer 2	CaSTMS8.Reverse primer: AGCATACAAATAAATAATAATGCATG
Product Length	100
Publication	[view all]

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG5	N/A	9.5	CaSTMS8	View
2	chickpea-ICC4958xPI489777-RIL-2012	LG5	N/A	91.2	CaSTMS8	View
3	chickpea-ICC4958xPI489777-RIL-2012-2	LG8	N/A	26.4	CaSTMS8	View
4	chickpea-ICC4958xPI489777-RIL-F10	LG5	N/A	9.14	CaSTMS8	View
5	chickpea-HadasxCr205-F2	LG5B-1	N/A	0.6	CaSTMS8	View
6	chickpea-ICC4958xPI489777-RIL-F10-2012	LG05	N/A	11.92	CaSTMS8	View
7	chickpea-ICC4958xPI489777-RIL-2015-2	LG5	N/A	110.8	CaSTMS8	View

Stock Name	Type
ILC3279	accession

Year	Publication
1999	Huttel B, Winter P, Weising K, Choumane W, Weigand F, Kahl G. Sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.). Genome. 1999; 42:210-217.
2000	Winter P, Benko-Iseppon A, Huttel B, Ratnaparkhe M, Tullu A, Sonnante G, Pfaff T, Tekeoglu M, Santra D, Sant V. A linkage map of the chickpea (Cicer arietinum L.) genome based on recombinant inbred lines from a C. arietinum x C. reticulatum cross: localization of resistance genes for fusarium wilt races 4 and 5. Theoretical and applied genetics. 2000 Nov; 101(7):1155-1163.