GA129a, GA129a (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	GA129a
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GA)14
Primer 1	GA129a.Forward primer: GGACATGGTGCTTCGAAAAT
Primer 2	GA129a.Reverse primer: CCCAACACCCTCACTTCATC
Product Length	134
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG5	N/A	149.2	GA129a	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG8	N/A	85.4	GA129a	View
3	chickpea-HadasxCr205-F2	LG6B	N/A	30.6	GA129a	View
4	chickpea-ICC3996xILWC184-F2	LG6	N/A	55.3	GA129a	View
5	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	50.59	GA129a	View
6	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	151.48	GA129a	View

Germplasm


Stock Name	Type
ILC3279	accession

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.