H1G20, H1G20 (genetic_marker) Cicer arietinum

Name	H1G20
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GA)7
Primer 1	H1G20.Forward primer: TCAACACTTGTTTGAGATTGTT
Primer 2	H1G20.Reverse primer: GGTTCTCTAATGGCTTTATTCA
Product Length	271
Publication	[view all]

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG4	N/A	33.6	H1G20	View
2	chickpea-ILC588xILC3279-RIL	LG4	N/A	26.6	H1G20	View
3	chickpea-ICC4958xPI489777-RIL-2011	LG4	N/A	43.1	H1G20	View
4	chickpea-ICCV2xJG62-RIL-F10-2011	LGIV	N/A	25.7	H1G20	View
5	chickpea-ICC4958xPI489777-RIL-F10	LG4	N/A	61.05	H1G20	View
6	chickpea-Hadas-2010	LG4	N/A	13.8	H1G20	View
7	chickpea-HadasxICC5810-RIL	LG4	N/A	13.8	H1G20	View
8	chickpea-ICC4958xPI489777-RIL-F10-2012	LG04	N/A	49.11	H1G20	View
9	chickpea-ICC4958xPI489777-RIL-2010	LG4	N/A	212.9	H1G20	View
10	Chickpea-JG62/ICCV05530-RIL	LG04	N/A	4.44	H1G20	View

Stock Name	Type
Hadas	accession

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.