|
Marker Overview
Name | H4D12 |
Genbank ID | N/A |
Type | SSR |
Species | Cicer arietinum |
Germplasm | Hadas |
Repeat Motif | (TAA)23 |
Primer 1 | H4D12.Forward primer: GTGGCAGCCATAATAATCAATGT |
Primer 2 | H4D12.Reverse primer: TTTGTTTCATATTTCTTGTTTCGTT |
Product Length | 200 |
Publication | [view all] |
Germplasm
Stock Name | Type |
Hadas | accession |
Publications
Year | Publication |
2005 | Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510. |
2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
|