H4D12, H4D12 (genetic_marker) Cicer arietinum

Name	H4D12
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(TAA)23
Primer 1	H4D12.Forward primer: GTGGCAGCCATAATAATCAATGT
Primer 2	H4D12.Reverse primer: TTTGTTTCATATTTCTTGTTTCGTT
Product Length	200
Publication	[view all]

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xCDCFrontier-F2	LG5	N/A	63.9	H4D12	View
2	chickpea-JG62xVijay-VijayxICC4958-RIL	LG1	N/A	62.6	H4D12	View
3	chickpea-VijayxICC4958-RIL-2011	LG2	N/A	57.8	H4D12	View
4	chickpea-ICCV96029xCDCFrontier-F2-2007	LG5	N/A	63.9	H4D12	View
5	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG1 (LGIII+V+XIII)	N/A	62.6	H4D12	View

Stock Name	Type
Hadas	accession

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.