ICCM0042, ICCM0042 (genetic_marker) Cicer arietinum

Name	ICCM0042
Genbank ID	FI856740
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(CA)4
Primer 1	ICCM0042.Forward primer: TTCGTGATATTCATCAAGGTGG
Primer 2	ICCM0042.Reverse primer: TTTGACGTACTCTGTGTTTTGTTT
Product Length	259
Publication	[view all]

Database	Accession
DB:genbank	FI856740

Stock Name	Type
ICC4958	accession

Year	Publication
2010	Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441.