ICCM0043, ICCM0043 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	ICCM0043
Genbank ID	FI856552
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(GA)6
Primer 1	ICCM0043.Forward primer: AAGATTGGATTCCACAACGC
Primer 2	ICCM0043.Reverse primer: ACAACCCACCCACACAAAC
Product Length	274
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	FI856552

Germplasm


Stock Name	Type
ICC4958	accession

Publications


Year	Publication
2010	Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441.