Ms/U380, Ms/U380 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	Ms/U380
Genbank ID	AJ410118
Type	CAPS
Species	Cicer sp.
Primer 1	Ms/U380.Forward primer: CACTCATTGCAATTTCCATGCTTCA
Primer 2	Ms/U380.Reverse primer: CAGTTGTTGTAGCAAGGGCACA
Restriction Enzyme	Taq I
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG3	N/A	6.3	Ms/U380	View
2	chickpea-ICC4958xPI489777-RIL-F10	LG3	N/A	26.5	Ms/U380	View
3	chickpea-ICC4958xPI489777-RIL-F10-2012	LG03	N/A	41.66	Ms/U380	View
4	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	93.9	Ms/U380	View

References

External references for this genetic_marker


Database	Accession
DB:genbank	AJ410118

Publications


Year	Publication
2010	Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441.