NCPGR103, NCPGR103 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR103
Genbank ID	EU877270
Type	STMS
Species	Cicer arietinum
Repeat Motif	(CT)2tc(CT)21
Primer 1	NCPGR103.Forward primer: ACAACCATATACTTTTGGCG
Primer 2	NCPGR103.Reverse primer: TTAGATGAAAAACGGGAGAA
Product Length	213
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	140.2	NCPGR103	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG2	N/A	143.1	NCPGR103	View
3	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	82.3	NCPGR103	View
4	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	121.77	NCPGR103	View

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877270

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.