NCPGR125, NCPGR125 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR125
Genbank ID	EU877292
Type	STMS
Species	Cicer arietinum
Repeat Motif	(CT)25
Primer 1	NCPGR125.Forward primer: CGGTTTTGTGTATGGTGAGT
Primer 2	NCPGR125.Reverse primer: GCATACCATTGTCAACCATT
Product Length	169
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea_SBD377_X_BGD112_RIL	LG7	N/A	160.8	NCPGR125	View
2	Chickpea-SBD377/BGD112-RIL-High_density	LG03	N/A	36.37	NCPGR125	View

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877292

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.