NCPGR133, NCPGR133 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR133
Genbank ID	EU877300
Type	STMS
Species	Cicer arietinum
Repeat Motif	(CT)19
Primer 1	NCPGR133.Forward primer: TGAGTGAAAGGTGGAAAAGA
Primer 2	NCPGR133.Reverse primer: AAGTTCACCTACCAATGCAA
Product Length	265
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877300

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.