|
Marker Overview
Name | NCPGR52 |
Genbank ID | AY446353 |
Type | STMS |
Species | Cicer arietinum |
Germplasm | Pusa362 |
Repeat Motif | (GA)2aa(GA)25 |
Primer 1 | NCPGR52.Forward primer: CAAGCTCTTTCAGAATTTGC |
Primer 2 | NCPGR52.Reverse primer: TACTGGTGGAAAAATGGATG |
Product Length | 245 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AY446353 |
Publications
Year | Publication |
2006 | Sethy NK, Shokeen B, Edwards KJ, Bhatia S. Development of microsatellite markers and analysis of intraspecific genetic variability in chickpea (Cicer arietinum L.). Theor Appl Genet. 2006; 112:1416-1428. |
2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
|