|
Marker Overview
Name | TFGMS20 |
Genbank ID | Pr016584993 |
Type | SSR |
Species | Cicer arietinum |
Germplasm | ICC4958 |
Repeat Motif | (AG)14 |
Primer 1 | TFGMS20.Forward primer: AGCGGTAGGTACTTAAGAAGG |
Primer 2 | TFGMS20.Reverse primer: AAGCTGTCTCCTAAATGGAAG |
Product Length | 155 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | Pr016584993 |
Publications
Year | Publication |
2013 | Kujur A, Bajaj D, Saxena MS, Tripathi S, Upadhyaya HD, Gowda CL, Singh S, Jain M, Tyagi AK, Parida SK. Functionally relevant microsatellite markers from chickpea transcription factor genes for efficient genotyping applications and trait association mapping. DNA research : an international journal for rapid publication of reports on genes and genomes. 2013 Aug; 20(4):355-74. |
2014 | Kujur A, Bajaj D, Saxena MS, Tripathi S, Upadhyaya HD, Gowda CLL, Singh S, Tyagi AK, Jain M, Parida SK. An efficient and cost-effective approach for genic microsatellite marker-based large-scale trait association mapping: identification of candidate genes for seed weight in chickpea. 2014; 34(1):241–265. |
|