|
Marker Overview
Name | TR24 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TTA)29 |
Primer 1 | TR24.Forward primer: AACAACTTCCTCTTATTTTCCA |
Primer 2 | TR24.Reverse primer: CAGTAAAAATCAGCCCAAAC |
Product Length | 155 |
Publication | [view all] |
Contact | Vincent Vadez
|
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
|