AA153, AA153 (genetic_marker) Pisum sativum

Name	AA153
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA153.Forward Primer: tttgatagtccgacttttccat
Primer 2	AA153.Reverse Primer: gtgacaaaagaattcaaaacgc
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-OrbxCDCStriker-RIL	LGII-1	N/A	31.4	AA153_253	View
2	pea-ShawneexBohatyr-RIL	LGIIa.3	N/A	89.2	AA153-370	View
3	pea-microsatComposite-2005	LGII	N/A	103.9	AA153-370	View
4	pea-KaspaxParafield-RIL	LGII	N/A	116.9	AA153	View
5	Pea-Integrated_Map-Sudheesh-2015	LG2	N/A	143.49	AA153	View
6	Pea-Composite_Map-Sudheesh-2015	LG2	N/A	117.12	AA153	View
7	pea-PennantxPI595933-F2	LG7	N/A	384.9	AA153	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2015	Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185.