AA155, AA155 (genetic_marker) Pisum sativum

Name	AA155
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA155.Forward Primer: catttgaatagttgcaatttca
Primer 2	AA155.Reverse Primer: tatttctccaccagagttaggt
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-OrbxCDCStriker-RIL	LGI-1	N/A	41.9	AA155	View
2	pea-consensusMap-2011	LGI	N/A	69.6	AA155	View
3	pea-KaspaxParafield-RIL	LGI	N/A	165.3	AA155	View
4	Pea-Integrated_Map-Sudheesh-2015	LG1	N/A	194.01	AA155	View
5	Pea-Composite_Map-Sudheesh-2015	LG1	N/A	207.6	AA155	View
6	Pea-002067/Reward-F8-RIL	LG01	N/A	82.61	AA155	View
7	pea-OrbxCDCStriker-RIL	LGI-2	N/A	59.5	AA155_354	View
8	pea-OrbxCDCStriker-RIL-2010	LGI-1	N/A	59.5	AA155_354	View
9	pea-DSPx90-2131-RIL-2015	LGI	N/A	69.6	PSAA155	View
10	Pea-Baccara/PI180693_Duarte-RIL-2016	LGI	N/A	55.1	AA155-365	View
11	Pea-Baccara/PI180693_GBS-RIL-2016	LGI	N/A	56.5	AA155-365	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2015	Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185.