|
Marker Overview
Name | AA403 |
Genbank ID | N/A |
Type | SSR |
Species | Pisum sativum |
Primer 1 | AA403.Forward Primer: ttagaagcatgagagcagtt |
Primer 2 | AA403.Reverse Primer: ttcttcgggtaatttgagtc |
Publication | [view all] |
Comment | Agrogène; PSMPS prefix for marker |
Publications
Year | Publication |
2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
|