AB139, AB139 (genetic_marker) Pisum sativum

Name	AB139
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB139.Forward Primer: gataagatctcaattcccttcccac
Primer 2	AB139.Reverse Primer: aaggaaaagaggatctcacacca
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGIIIc.3	N/A	5.1	AB139-169	View
2	pea-consensusMap-2011	LGIII	N/A	244	AB139	View
3	pea-PennantxPI595933-F2	LG4	N/A	193.8	AB139	View
4	pea-microsatComposite-2005	LGIII	N/A	259.3	AB139-196	View
5	pea-ShawneexBohatyr-F7-RIL	LGIII	N/A	341	AB139_196	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.