AB140, AB140 (genetic_marker) Pisum sativum

Name	AB140
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB140.Forward Primer: ccagattcatgaagggcataca
Primer 2	AB140.Reverse Primer: gatgaaatttcgtttctctctgtctc
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIII	N/A	227.2	AB140	View
2	pea-TeresexChampagne-RIL	LGIIIb.2	N/A	89	AB140	View
3	pea-TeresexK586-RIL	LGIIIb.1	N/A	130.4	AB140	View
4	pea-consensusMap-2011	LGIII	N/A	217.8	AB140	View
5	pea-microsatComposite-2005	LGIII	N/A	227	AB140	View
6	Pea-Composite_Map-RIL	LGIII	N/A	161.3	AB140	View
7	pea-PennantxPI595933-F2	LG7	N/A	555.2	AB140	View
8	pea-DSPx90-2131-RIL-2015	LGIIIb	N/A	30	PSAB140	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2014	Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126.