|
Marker Overview
Name | AB68 |
Genbank ID | N/A |
Type | SSR |
Species | Pisum sativum |
Primer 1 | AB68.Forward Primer: agcatttgtgcagttacaatttcg |
Primer 2 | AB68.Reverse Primer: tgattcaccatcaccatgtgctat |
Publication | [view all] |
Comment | Agrogène; PSMPS prefix for marker |
Publications
Year | Publication |
2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
|