AB68, AB68 (genetic_marker) Pisum sativum

Name	AB68
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB68.Forward Primer: agcatttgtgcagttacaatttcg
Primer 2	AB68.Reverse Primer: tgattcaccatcaccatgtgctat
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIII	N/A	231.3	AB68	View
2	pea-TeresexK586-RIL	LGIIIb.1	N/A	134	AB68	View
3	pea-consensusMap-2011	LGIII	N/A	221.5	AB68	View
4	pea-microsatComposite-2005	LGIII	N/A	230.3	AB68	View
5	pea-PennantxPI595933-F2	LG3	N/A	312.2	AB68	View
6	Pea-002067/Reward-F8-RIL	LG04	N/A	250.23	AB68	View
7	Pea-00-2067/Reward-F8-RIL-2022	Chr5	N/A	250.2	AB68	View
8	pea-DSPx90-2131-RIL-2015	LGIIIb	N/A	33.9	PSAB68	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.