AD141, AD141 (genetic_marker) Pisum sativum

Name	AD141
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD141.Forward Primer: aatttgaaagaggcggatgtg
Primer 2	AD141.Reverse Primer: acttctctccaacatccaacga
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGVI	N/A	72	AD141	View
2	pea-TeresexChampagne-RIL	LGVIa.2	N/A	84.1	AD141	View
3	pea-consensusMap-2011	LGIII	N/A	149.4	AD141	View
4	pea-TeresexChampagne-RIL-2008	LG6	N/A	88.3	AD141	View
5	Pea-Composite_Map-RIL	LGVI	N/A	61.6	AD141	View
6	pea-TeresexChampagne-RIL-2009	LG6	N/A	88.3	AD141	View
7	pea-PennantxPI595933-F2	LG7	N/A	489.9	AD141	View
8	pea-ShawneexBohatyr-RIL	LGIIIb.3	N/A	75.1	AD141-342	View
9	pea-microsatComposite-2005	LGIII	N/A	161.1	AD141-342	View
10	pea-microsatComposite-2005	LGVI	N/A	70.1	AD141-342	View
11	pea-ShawneexBohatyr-F7-RIL	LGIII	N/A	184.7	AD141_342	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2014	Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126.