AD160, AD160 (genetic_marker) Pisum sativum

Name	AD160
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD160.Forward Primer: accagtcaaatggttagaaagt
Primer 2	AD160.Reverse Primer: gaatggaaaagagaatcaagtt
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGVI.3	N/A	3.5	AD160-190	View
2	pea-microsatComposite-2005	LGVI	N/A	9.1	AD160-190	View
3	pea-consensusMap-2011	LGVI	N/A	18.7	AD160	View
4	pea-AlfettaxCDCBronco-RIL	LGVI	N/A	7.4	AD160	View
5	pea-PennantxPI595933-F2	LG5	N/A	128.1	AD160	View
6	Pea-HUVP1_x_FC1-RIL	LGVI	N/A	19.7	AD160	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2015	Rai R, Singh AK, Chand R, Srivastava CP, Joshi AK, Singh BD. Genomic regions controlling components of resistance for pea rust caused by Uromyces fabae (Pers.) de-Bary. 2015.