AD51, AD51 (genetic_marker) Pisum sativum

Name	AD51
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD51.Forward Primer: atgaagtaggcatagcgaagat
Primer 2	AD51.Reverse Primer: gattaaataaagttcgatggcg
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGVI	N/A	38	AD51	View
2	pea-TeresexChampagne-RIL	LGVIa.2	N/A	47.5	AD51	View
3	pea-ShawneexBohatyr-RIL	LGVI.3	N/A	48.1	AD51	View
4	pea-TeresexK586-RIL	LGVI.1	N/A	28.2	AD51	View
5	pea-consensusMap-2011	LGVI	N/A	45.6	AD51	View
6	pea-microsatComposite-2005	LGVI	N/A	41.2	AD51	View
7	pea-PennantxPI595933-F2	LG3	N/A	0	AD51	View
8	Pea-Composite_Map-RIL	LGVI	N/A	37.8	AD51	View
9	pea-TeresexChampagne-RIL-2009	LG6	N/A	49.8	AD51	View
10	pea-OrbxCDCStriker-RIL	LGIV-1	N/A	60.6	AD51_232	View
11	pea-OrbxCDCStriker-RIL-2010	LGIV-1	N/A	60.6	AD51_232	View
12	pea-DSPx90-2131-RIL-2015	LGVI	N/A	35.5	PSAD51	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2014	Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126.