AD68, AD68 (genetic_marker) Pisum sativum

Name	AD68
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD68.Forward Primer: ggtctaatccatagtcggaaaa
Primer 2	AD68.Reverse Primer: cagaaacaccattccaacataa
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGV	N/A	61	AD68	View
2	pea-DSPx90-2131-RIL-2015	LGV	N/A	10.9	PSAD68	View
3	Pea-Baccara/PI180693_Duarte-RIL-2016	LGV	N/A	9.7	AD68-292	View
4	Pea-Baccara/PI180693_GBS-RIL-2016	LGV	N/A	22.5	AD68-292	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.