|
Marker Overview
Name | GBSSR-VF-263 |
Genbank ID | KC218798 |
Type | SSR |
Species | Vicia faba |
Repeat Motif | (ACA)6 |
Primer 1 | GBSSR-VF-263.Forward Primer: ATGCCACCCTCACTTTCC |
Primer 2 | GBSSR-VF-263.Reverse Primer: TCCTTCCAAATTCAGAATCC |
Product Length | 157 |
Publication | [view all] |
Contact | MA El-Esawi
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | KC218798 |
Publications
Year | Publication |
2013 | Suresh S, Park JH, Cho GT, Lee HS, Baek HJ, Lee SY, Chung JW. Development and Molecular Characterization of 55 Novel Polymorphic cDNA-SSR Markers in Faba Bean (Vicia faba L.) Using 454 Pyrosequencing. Molecules. 2013; 18:1844-1856. |
2017 | Benidire L, Lahrouni M, Daoui K, Fatemi ZEA, Gomez Carmona R, Göttfert M, Oufdou K. Phenotypic and genetic diversity of Moroccan rhizobia isolated from Vicia faba and study of genes that are likely to be involved in their osmotolerance. Systematic and applied microbiology. 2017 Nov 03. |
2017 | El-Esawi MA. SSR analysis of genetic diversity and structure of the germplasm of faba bean (Vicia faba L.). Comptes rendus biologies. 2017 Oct 26. |
|