|
Marker Overview
Name | Lup052 |
Genbank ID | BG149132 |
Type | CAPS |
Species | Vicia faba |
Primer 1 | Lup052.Forward: CTGGTTCTGTTCTTCAACTGTA |
Primer 2 | Lup052.Forward primer: ctggttctgttcttcaactgta |
Primer 3 | Lup052.Reverse: GTCATATCCTTTCCATGCAC |
Primer 4 | Lup052.Reverse Primer: gtcatatcctttccatgcac |
Restriction Enzyme | MnII |
Publication | [view all] |
Contact | Simon Ellwood
|
Comment | 60S ribosomal L30-like protein |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | BG149132 |
Publications
Year | Publication |
2008 | Ellwood SR, Phan HT, Jordan M, Hane J, Torres AM, Avila CM, Cruz-Izquierdo S, Oliver RP. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC genomics. 2008; 9:380. |
2006 | Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A, O'Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones MGK, Bellgard M, Ksiazkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA. The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula. Theor Appl Genet. 2006; 113:225-238. |
|