Beta-amylase-like_1, Beta-amylase-like_1 (genetic_marker) Medicago truncatula | PulseDB

Marker Overview

Marker Overview


Name	Beta-amylase-like_1
Genbank ID	XM_003593956
Type	gene marker
Species	Medicago truncatula
Primer 1	Beta-amylase-like_1.Ps_1523 (S): GCTGTTCATGCTGAACCGATCAGAG
Primer 2	Beta-amylase-like_1.Ps_1525: TCTTTGTAACACTGTCCCGACCGA
Product Length	501
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	XM_003593956

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.