|
Marker Overview
Name | A-SSR-0023 |
Genbank ID | N/A |
Type | SSR |
Species | Cajanus cajan |
Repeat Motif | (CCTTCT)5 |
Primer 1 | A-SSR-0023.Forward: CTTTCCCTTCTCTCTCAACAC |
Primer 2 | A-SSR-0023.Reverse: AAGCAGAAGCAGAAGCAGAG |
Max Length | 160 |
Publication | [view all] |
Contact | MN Singh Nagendra Singh
|
Publications
Year | Publication |
2013 | Singh AK, Rai VP, Chand R, Singh RP, Singh MN. Genetic diversity studies and identification of SSR markers associated with Fusarium wilt (Fusarium udum) resistance in cultivated pigeonpea (Cajanus cajan). Journal of genetics. 2013; 92(2):273-80. |
2012 | Kumawat G, Raje RS, Bhutani S, Pal JK, Mithra AS, Gaikwad K, Sharma TR, Singh NK. Molecular mapping of QTLs for plant type and earliness traits in pigeonpea (Cajanus cajan L. Millsp.). BMC genetics. 2012 Oct 08; 13:84. |
|