|
Marker Overview
Name | Lup241 |
Genbank ID | CA410838 |
Type | gene marker |
Species | Lupinus angustifolius |
Primer 1 | Lup241.Forward: CTCCTTCCTCCTCGTATCAT |
Primer 2 | Lup241.Reverse: CTCATTCCTATCATGCAGTCTA |
Publication | [view all] |
Contact | Simon Ellwood
|
Comment | NAD+ dependent malate oxidoreductase |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | CA410838 |
Publications
Year | Publication |
2006 | Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A, O'Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones MGK, Bellgard M, Ksiazkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA. The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula. Theor Appl Genet. 2006; 113:225-238. |
|