CaM1567, CaM1567 (genetic_marker) Cicer arietinum

Name	CaM1567
Genbank ID	EI880807
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(TAA)9
Primer 1	CaM1567.Forward primer: CGGAATGCTGGTTGTAACAC
Primer 2	CaM1567.Reverse primer: TGAGGACTAAGATAATAGCAATCCAA
Product Length	276
Publication	[view all]
Contact	Vincent Vadez

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea-ICC4958_x_ICC1882-RIL-2018	CaLG07	N/A	46.26	CaM1567	View
2	Chickpea-ICC4958× ICC1882-RIL	CaLG07	N/A	46.24	CaM1567	View

Database	Accession
DB:genbank	EI880807

Name	Details
Vincent Vadez	First name: Vincent Last name: Vadez Title: Researcher Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) Address: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India Country: India Email: v.vadez@cgiar.org

Stock Name	Type
ICC4958	accession

Year	Publication
2011	Thudi M, Bohra A, Nayak SN, Varghese N, Shah TM, Penmetsa RV, Thirunavukkarasu N, Gudipati S, Gaur PM, Kulwal PL, Upadhyaya HD, Kavikishor PB, Winter P, Kahl G, Town CD, Kilian A, Cook DR, Varshney RK. Novel SSR markers from BAC-end sequences, DArT arrays and a comprehensive genetic map with 1,291 marker loci for chickpea (Cicer arietinum L.). PloS one. 2011; 6(11):e27275.
2018	Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29.