NCPGR226, NCPGR226 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR226
Genbank ID	EU877393
Type	STMS
Species	Cicer arietinum
Repeat Motif	(CT)17
Primer 1	NCPGR226.Forward primer: GACTGCATGTTTTCTTCTCG
Primer 2	NCPGR226.Reverse primer: ACCACTTCAAAGCCTATTCA
Product Length	205
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG4	N/A	96.4	NCPGR226	View
2	chickpea-ICCV2xJG62-RIL-F10-2011	LGVI	N/A	102.2	NCPGR226	View
3	chickpea-ICC4958xPI489777-RIL-2012-2	LG4	N/A	98.3	NCPGR226	View
4	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	94.1	NCPGR226	View
5	Chickpea_SBD377_X_BGD112_RIL	LG7	N/A	59.5	NCPGR226	View
6	Chickpea-SBD377/BGD112-RIL-High_density	LG05	N/A	70.67	NCPGR226	View
7	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	152.32	NCPGR226	View

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877393

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.