AA387, AA387 (genetic_marker) Pisum sativum

Name	AA387
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA387.Forward Primer: cgtcccacataagtggtcat
Primer 2	AA387.Reverse Primer: gagggtgaattacaagaaagg
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGVII	N/A	154.6	AA387	View
2	pea-TeresexChampagne-RIL	LGVIIa.2-LGVIIb.2	N/A	142.2	AA387	View
3	pea-ShawneexBohatyr-RIL	LGVII.3	N/A	209.9	AA387	View
4	pea-consensusMap-2011	LGVII	N/A	37.3	AA387	View
5	pea-microsatComposite-2005	LGVII	N/A	172.3	AA387	View
6	pea-KaspaxParafield-RIL	LGVII	N/A	40.2	AA387	View
7	Pea-Integrated_Map-Sudheesh-2015	LG7	N/A	93.86	AA387	View
8	Pea-Composite_Map-Sudheesh-2015	LG7	N/A	95.95	AA387	View
9	pea-TeresexChampagne-RIL-2009	LG7	N/A	124.2	AA387	View
10	pea-PennantxPI595933-F2	LG7	N/A	773.6	AA387	View
11	Pea-Baccara/PI180693_Duarte-RIL-2016	LGVII	N/A	128.6	AA387-469	View
12	Pea-Baccara/PI180693_GBS-RIL-2016	LGVII	N/A	110.3	AA387-469	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2015	Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185.