AB111, AB111 (genetic_marker) Pisum sativum

Name	AB111
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB111.Forward Primer: tggagcagttatgaggaaaatttg
Primer 2	AB111.Reverse Primer: ttgcatatgtgagaatttatagcaattaat
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGIII	N/A	186.6	AB111	View
2	pea-PennantxPI595933-F2	LG3	N/A	341.7	AB111	View
3	pea-ShawneexBohatyr-RIL	LGIIIb.3	N/A	96.7	AB111-166	View
4	pea-microsatComposite-2005	LGIII	N/A	190.4	AB111-166	View
5	pea-ShawneexBohatyr-F7-RIL	LGIII	N/A	206.3	AB111_166	View
6	Pea-Baccara/PI180693_Duarte-RIL-2016	LGIII	N/A	128.3	AB111-179	View
7	pea-BaccaraxPI180693-RIL	LGIII	N/A	128.3	AB111-179	View
8	Pea-Baccara/PI180693_GBS-RIL-2016	LGIII	N/A	111.1	AB111-179	View

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2015	Jain S, Weeden NF, Kumar A, Chittem K, McPhee K. Functional Codominant Marker for Selecting the Fw Gene Conferring Resistance to Fusarium Wilt Race 1 in Pea. 2015; 55(6):2639-2646.