SSR156, SSR156 (genetic_marker) Lens culinaris

Name	SSR156
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Repeat Motif	(TC)2(TG)13
Primer 1	SSR156.Forward Primer: GTACATTGAACAGCATCATC
Primer 2	SSR156.Reverse Primer: CAAATGGGCATGAAAGGAG
Product Length	176
Publication	[view all]
Contact	Michael Baum Sukhjiwan Kaur

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-CDCRobinx964a-46-RIL	LG5	N/A	80.1	SSR156	View
2	lentil-ILL5588xILL5722-F5-RIL	LGV	N/A	30	SSR156	View
3	lentil-ILL5588xILL5722-F5-RIL-2012	LGV	N/A	120.7	SSR156	View
4	lentil-ILL5588xL692-16-1-RIL	LG7	N/A	0	SSR156	View
5	lentil-L830xILWL77-F2	LGV	N/A	190.6	SSR156	View
6	Lentil-Consensus-RIL-2016	LG5	N/A	288.34	SSR156	View
7	Lentil- Northfield_x_Digger-RIL-2016	LG5	N/A	220.5	SSR156	View
8	Lentil-CDC_Robin/964a-46-RIL-2017	LG05	N/A	89.6	SSR156	View
9	Lentil-ILL2024/ILL6788-F6-RIL	LG05-2	N/A	45.4	SSR156	View
10	Lentil-WA8649090/Precoz-F10-RIL	LG05	N/A	50.9	SSR156	View

Name	Details
Michael Baum	First name: Michael Last name: Baum Institution: International Centre for Agricultural Research in the Dry Areas Address: ICARDA, PO Box 5466, Aleppo, Syria Country: Syria Email: M.Baum@cgiar.org
Sukhjiwan Kaur	First name: Sukhjiwan Last name: Kaur Title: Researcher Institution: La Trobe University Address: Biosciences Research, Agriculture Victoria, AgriBio, La Trobe University, Bundoora, VIC, Australia Country: Australia Email: sukhjiwan.kaur@ecodev.vic.gov.au Last update: Apr 2018

Year	Publication
2005	Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77.
2015	Mekonnen F, Mekbib F, Kumar S, Ahmed S, Sharma TR. Molecular Diversity and Population Structure of the Ethiopian Lentil (Lens Culinaris Medikus) Genotype Assessment Using SSR Markers. Journal of Crop Science and Biotechnology. 2015; 19(1):1-15.
2016	Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604.