|
Marker Overview
Name | BM-0171 |
Genbank ID | N/A |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (GA)13 |
Primer 1 | BM-0171.Forward: TGGCATTTCAGATTAACACTCC |
Primer 2 | BM-0171.Reverse: CTTCCTTGCTGTTTCCACTG |
Product Length | 149 |
Publication | [view all] |
Contact | Rafael Lozano J. Tohme
|
Publications
Year | Publication |
2012 | Yuste-Lisbona FJ, Santalla M, Capel C, García-Alcázar M, De La Fuente M, Capel J, De Ron AM, Lozano R. Marker-based linkage map of Andean common bean (Phaseolus vulgaris L.) and mapping of QTLs underlying popping ability traits. BMC plant biology. 2012 Aug 09; 12:136. |
2002 | Gaitan-Solis E, Duque MC, Edwards KJ, Tohme J. Microsatellite Repeats in Common Bean (Phaseolus vulgaris): Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp.. Crop Science. 2002; 42:2128-2136. |
|